Stem-loop sequence cel-mir-228

Accession

MI0000303 (change log)

Description

Caenorhabditis elegans miR-228 stem-loop

Gene family

MIPF0000292; mir-228

Literature search

10 open access papers mention cel-mir-228
(28 sentences)

Stem-loop

   -----       -        a    c    c    a   a   -  aug a 
5'      ccuuauc ccguucgc augg acug auga uuc cgg cu   c u
        ||||||| |||||||| |||| |||| |||| ||| ||| ||   | a
3'      ggaguag ggcaggcg uacc uggc uacu agg gcc ga   g a
   uaauu       u        a    a    a    -   c   a  -ca c 

Deep sequencing

4405924 reads, 2.01e+04 reads per million, 17 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Comments

This precursor sequence was predicted by comparative computational approaches [1,2]. Northern blotting confirmed that the strand containing the predicted miR is predominantly expressed, and the 5' and 3' ends were confirmed later [4].

Genome context

• Coordinates (WBcel235; GCA_000002985.3): chrIV: 5562025-5562122 [+]
• Overlapping transcripts:

  intergenic

Clustered miRNAs

< 10kb from cel-mir-228

• cel-mir-228: chrIV: 5562025-5562122 [+]
• cel-mir-790: chrIV: 5566422-5566491 [+]

Database links

• RNAcentral:URS00002690E3_6239
• miRBase Tracker:MI0000303

Mature sequence cel-miR-228-5p

• Accession: MIMAT0000283
• Previous IDs: cel-miR-228
• Sequence: 16 - aauggcacugcaugaauucacgg - 38
• Deep sequencing: 4400928 reads, 17 experiments
• Evidence: experimental; cloned [1], Northern [1,3], PCR [3], 454 [4], Illumina [5,7], CLIPseq [6]
• Database links:
  • RNAcentral:URS0000080150_6239
• Predicted targets:
  • TargetScanWorm:cel-miR-228
  • microrna.org:cel-miR-228-5p

Mature sequence cel-miR-228-3p

• Accession: MIMAT0020327
• Previous IDs: cel-miR-228*
• Sequence: 58 - gcggaucauacgguaccauagc - 79
• Deep sequencing: 4954 reads, 15 experiments
• Evidence: experimental; Illumina [7]
• Database links:
  • RNAcentral:URS00003CA3FD_6239

References

1. PMID:12672692 "The microRNAs of Caenorhabditis elegans" Lim LP, Lau NC, Weinstein EG, Abdelhakim A, Yekta S, Rhoades MW, Burge CB, Bartel DP Genes Dev. 17:991-1008(2003).
2. PMID:12747828 "MicroRNAs and other tiny endogenous RNAs in C. elegans" Ambros V, Lee RC, Lavanway A, Williams PT, Jewell D Curr Biol. 13:807-818(2003).
3. PMID:12769849 "Computational and experimental identification of C. elegans microRNAs" Grad Y, Aach J, Hayes GD, Reinhart BJ, Church GM, Ruvkun G, Kim J Mol Cell. 11:1253-1263(2003).
4. PMID:17174894 "Large-scale sequencing reveals 21U-RNAs and additional microRNAs and endogenous siRNAs in C. elegans" Ruby JG, Jan C, Player C, Axtell MJ, Lee W, Nusbaum C, Ge H, Bartel DP Cell. 127:1193-1207(2006).
5. PMID:19460142 "Dynamic expression of small non-coding RNAs, including novel microRNAs and piRNAs/21U-RNAs, during Caenorhabditis elegans development" Kato M, de Lencastre A, Pincus Z, Slack FJ Genome Biol. 10:R54(2009).
6. PMID:20062054 "Comprehensive discovery of endogenous Argonaute binding sites in Caenorhabditis elegans" Zisoulis DG, Lovci MT, Wilbert ML, Hutt KR, Liang TY, Pasquinelli AE, Yeo GW Nat Struct Mol Biol. 17:173-179(2010).
7. PMID:21307183 "Improved annotation of C. elegans microRNAs by deep sequencing reveals structures associated with processing by Drosha and Dicer" Warf MB, Johnson WE, Bass BL RNA. 17:563-577(2011).