![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence cel-mir-228 |
||||||
Accession | MI0000303 (change log) | |||||
Description | Caenorhabditis elegans miR-228 stem-loop | |||||
Gene family | MIPF0000292; mir-228 | |||||
Literature search |
![]()
10 open access papers mention cel-mir-228 | |||||
Stem-loop |
----- - a c c a a - aug a 5' ccuuauc ccguucgc augg acug auga uuc cgg cu c u ||||||| |||||||| |||| |||| |||| ||| ||| || | a 3' ggaguag ggcaggcg uacc uggc uacu agg gcc ga g a uaauu u a a a - c a -ca c |
|||||
Deep sequencing |
| |||||
Confidence |
Annotation confidence: high
| |||||
Comments |
This precursor sequence was predicted by comparative computational approaches [1,2]. Northern blotting confirmed that the strand containing the predicted miR is predominantly expressed, and the 5' and 3' ends were confirmed later [4]. |
|||||
Genome context |
|
|||||
Clustered miRNAs |
|
|||||
Database links |
|
Mature sequence cel-miR-228-5p |
|
Accession | MIMAT0000283 |
Previous IDs | cel-miR-228 |
Sequence |
16 - aauggcacugcaugaauucacgg - 38 |
Deep sequencing | 4400928 reads, 17 experiments |
Evidence | experimental; cloned [1], Northern [1,3], PCR [3], 454 [4], Illumina [5,7], CLIPseq [6] |
Database links |
|
Predicted targets |
|
Mature sequence cel-miR-228-3p |
|
Accession | MIMAT0020327 |
Previous IDs | cel-miR-228* |
Sequence |
58 - gcggaucauacgguaccauagc - 79 |
Deep sequencing | 4954 reads, 15 experiments |
Evidence | experimental; Illumina [7] |
Database links |
|
References |
|
1 |
PMID:12672692
"The microRNAs of Caenorhabditis elegans"
Genes Dev. 17:991-1008(2003).
|
2 |
PMID:12747828
"MicroRNAs and other tiny endogenous RNAs in C. elegans"
Curr Biol. 13:807-818(2003).
|
3 |
PMID:12769849
"Computational and experimental identification of C. elegans microRNAs"
Mol Cell. 11:1253-1263(2003).
|
4 |
PMID:17174894
"Large-scale sequencing reveals 21U-RNAs and additional microRNAs and endogenous siRNAs in C. elegans"
Cell. 127:1193-1207(2006).
|
5 | |
6 |
PMID:20062054
"Comprehensive discovery of endogenous Argonaute binding sites in Caenorhabditis elegans"
Nat Struct Mol Biol. 17:173-179(2010).
|
7 |