Accession
MI0000291
Symbol
HGNC:
MIR215
Description
Homo sapiens
hsa-mir-215 precursor miRNA
Gene family
MIPF0000063;
mir-192
Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?
Hsa-mir-215 is a microRNA (miRNA) that has been studied in various contexts. It has been identified as one of the miRNAs with 20 or fewer validated targets in miRTarBase, along with hsa-miR-21-5p and hsa-miR-124-3p [PMC5484592]. In certain studies, hsa-mir-215 has been found to be significantly associated with target genes involved in specific pathways [PMC8876010]. It has also been suggested as a potential prognostic indicator for chemotherapeutic benefits in STS metastasis [PMC4434893]. In the context of colorectal cancer (CRC), hsa-mir-215 has shown associations with disease stage and CRC-specific mortality [PMC6007480]. Additionally, hsa-mir-215 has been found to be upregulated in NPM1 mutated AML compared to NPM1 wild-type AML [PMC7851519]. It is worth noting that hsa-mir-215 exhibits a high correlation with Esophageal Neoplasms [PMC6929455]. In tumor tissues, the expression of hsa-mir-215 is significantly lower compared to adjacent normal colon epithelial tissue [PMC8798538]. Furthermore, it has been identified as one of the miRNAs involved in specific molecular mechanisms, acting as a direct inhibitor for certain targets [PMC8233096]. In different studies, it was found to be both upregulated and downregulated depending on the context and disease type.
Literature search
102 open access papers mention hsa-mir-215
(417 sentences)
(417 sentences)
Sequence
21962
reads,
146
reads per million, 86 experiments
aucauucagaaaugguauacaggaaaAUGACCUAUGAAUUGACAGACaauauagcugaguuugUCUGUCAUUUCUUUAGGCCAAUAuucuguaugacugugcuacuucaa
...........(((((((((((((...((.((((.(((.((((((((((...........)))))))))).)))..)))).))...)))))))).)))))..........
...........(((((((((((((...((.((((.(((.((((((((((...........)))))))))).)))..)))).))...)))))))).)))))..........
Structure
aucauucagaa - aaA A -U U uaua
auggu auacagga UG CCUA GAA UGACAGACaa g
||||| |||||||| || |||| ||| |||||||||| c
uguca uaugucuu AC GGAU CUU ACUGUCUguu u
-aacuucaucg g AUA C UU U ugag
Annotation confidence
Not enough data
Do you think this miRNA is real?
Comments
This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences [1]. Expression of the excised miR has been validated in zebrafish, and the 5' end mapped by PCR. Landgraf et al. confirm expression in human [2].
Genome context
chr1: 220117853-220117962 [-]
Clustered miRNAs
1 other miRNA is < 10 kb from hsa-mir-215
| Name | Accession | Chromosome | Start | End | Strand | Confidence |
|---|
Disease association
hsa-mir-215 is associated with one or more human diseases in the Human microRNA Disease Database
| Disease | Description | Category | PubMed ID |
|---|
Biological pathways
hsa-mir-215 is involved in one or more biological pathways:
(Source: Reactome)
(Source: Reactome)
Biological reactions
hsa-mir-215 is involved in one or more regulation/signalling events:
(Source: Reactome)
(Source: Reactome)
Database links
Mature hsa-miR-215-5p
| Accession | MIMAT0000272 |
| Description | Homo sapiens hsa-miR-215-5p mature miRNA |
| Sequence | 27 - AUGACCUAUGAAUUGACAGAC - 47 |
| Evidence |
experimental
cloned [2], Illumina [3] |
| Database links |
|
| Predicted targets |
|
Mature hsa-miR-215-3p
| Accession | MIMAT0026476 |
| Description | Homo sapiens hsa-miR-215-3p mature miRNA |
| Sequence | 64 - UCUGUCAUUUCUUUAGGCCAAUA - 86 |
| Evidence |
experimental
Illumina [3] |
References
|
