Stem-loop sequence hsa-mir-215

Accession

MI0000291 (change log)

Symbol

HGNC:MIR215

Description

Homo sapiens miR-215 stem-loop

Gene family

MIPF0000063; mir-192

Literature search

102 open access papers mention hsa-mir-215
(415 sentences)

Stem-loop

   aucauuca   a      ------      a a  a    -u   u          uaua 
5'         gaa ugguau      acagga a ug ccua  gaa ugacagacaa    g
           ||| ||||||      |||||| | || ||||  ||| ||||||||||    c
3'         cuu aucgug      ugucuu u ac ggau  cuu acugucuguu    u
   ------aa   c      ucagua      a a  c    uu   u          ugag 

Deep sequencing

883763 reads, 686 reads per million, 159 experiments

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Comments

This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences [1]. Expression of the excised miR has been validated in zebrafish, and the 5' end mapped by PCR. Landgraf et al. confirm expression in human [2].

Genome context

• Coordinates (GRCh38; GCA_000001405.15): chr1: 220117853-220117962 [-]
• Overlapping transcripts:

  sense

  OTTHUMT00000098802 ; SLC30A10-002; intron 1

  ENST00000484239 ; SLC30A10-002; intron 1

  ENST00000536446 ; SLC30A10-201; intron 1

Clustered miRNAs

< 10kb from hsa-mir-215

• hsa-mir-194-1: chr1: 220118157-220118241 [-]
• hsa-mir-215: chr1: 220117853-220117962 [-]

Database links

• EntrezGene:MIR215
• HGNC:MIR215
• RNAcentral:URS00000F31F4_9606
• miRBase Tracker:MI0000291

Mature sequence hsa-miR-215-5p

• Accession: MIMAT0000272
• Sequence: 27 - augaccuaugaauugacagac - 47
• Deep sequencing: 883731 reads, 159 experiments
• Evidence: experimental; cloned [2], Illumina [3]
• Database links:
  • RNAcentral:URS0000315B13_9606
• Predicted targets:
  • TargetScanVert:hsa-miR-215-5p
  • miRDB:hsa-miR-215-5p
  • microrna.org:hsa-miR-215-5p

Mature sequence hsa-miR-215-3p

• Accession: MIMAT0026476
• Sequence: 64 - ucugucauuucuuuaggccaaua - 86
• Deep sequencing: 20 reads, 12 experiments
• Evidence: experimental; Illumina [3]
• Predicted targets:
  • TargetScanVert:hsa-miR-215-3p
  • miRDB:hsa-miR-215-3p

References

1. PMID:12624257 "Vertebrate microRNA genes" Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP Science. 299:1540(2003).
2. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3. PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).