Accession
MI0000288
Symbol
HGNC:
MIR212
Description
Homo sapiens
hsa-mir-212 precursor miRNA
Gene family
MIPF0000065;
mir-132
Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?
MIR212 is a microRNA that has been studied for its effects on the proliferation and apoptosis of ovarian cancer (OC) cell lines [PMC6995389]. In a meta-analysis of Series 1 6 and 10-month data, as well as human BA9 data, eight microRNAs (Mir615, Mir135b, MIR212, Mir132, Mir20a, Mir708, Mir99a, Mir138-2) were found to be significantly associated with CAG length [PMC5764268]. These microRNAs passed the p-value threshold of 0.05 and had a false discovery rate (FDR) less than 0.05 [PMC5764268]. The specific role of MIR212 in this association was not mentioned in the given context. However, it is worth noting that MIR212 has been previously implicated in various biological processes and diseases. For example, it has been shown to be involved in the regulation of cell proliferation and apoptosis in different cancer types [PMC6995389]. Additionally, MIR212 has been associated with neurodegenerative diseases such as Alzheimer's disease [PMC5764268]. Further research is needed to fully understand the role of MIR212 in OC cell lines and its association with CAG length.
Literature search
129 open access papers mention hsa-mir-212
(875 sentences)
(875 sentences)
Sequence
8023
reads,
228
reads per million, 89 experiments
cggggcaccccgcccggacagcgcgccggcACCUUGGCUCUAGACUGCUUACUgcccgggccgcccucagUAACAGUCUCCAGUCACGGCCaccgacgccuggccccgcc
((((((...((....)).(((.(((.(((..((.(((((..((((((.((((((...(((...))).))))))))))))..))))).))...))).))))))))))))..
((((((...((....)).(((.(((.(((..((.(((((..((((((.((((((...(((...))).))))))))))))..))))).))...))).))))))))))))..
Structure
-- accccgcccgga c c -cA U CU C ccc c cggggc cag gcg cgg CC UGGCU AGACUG UUACUg ggg |||||| ||| ||| ||| || ||||| |||||| |||||| ||| c gccccg guc cgc gcc GG ACUGA UCUGAC AAUgac ccc cc ------------ - a aCC C CC - --u g
Annotation confidence
High
Do you think this miRNA is real?
Comments
This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences [1]. Expression of the excised miR has been validated in zebrafish, and the 5' end mapped by PCR. The 3' end was not experimentally determined. The sequence maps to human chromosome 17, but its expression has not been experimentally verified in human.
Genome context
chr17: 2050271-2050380 [-]
Clustered miRNAs
1 other miRNA is < 10 kb from hsa-mir-212
| Name | Accession | Chromosome | Start | End | Strand | Confidence |
|---|
Disease association
hsa-mir-212 is associated with one or more human diseases in the Human microRNA Disease Database
| Disease | Description | Category | PubMed ID |
|---|
Database links
Mature hsa-miR-212-3p
| Accession | MIMAT0000269 |
| Description | Homo sapiens hsa-miR-212-3p mature miRNA |
| Sequence | 71 - UAACAGUCUCCAGUCACGGCC - 91 |
| Evidence | not_experimental |
| Database links |
|
| Predicted targets |
|
Mature hsa-miR-212-5p
| Accession | MIMAT0022695 |
| Description | Homo sapiens hsa-miR-212-5p mature miRNA |
| Sequence | 31 - ACCUUGGCUCUAGACUGCUUACU - 53 |
| Evidence | not_experimental |
| Database links |
|
| Predicted targets |
|
References
|
