![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-147a |
|||||
Accession | MI0000262 (change log) | ||||
Previous IDs | hsa-mir-147 | ||||
Symbol | HGNC:MIR147A | ||||
Description | Homo sapiens miR-147a stem-loop | ||||
Gene family | MIPF0000105; mir-147 | ||||
Literature search |
![]()
42 open access papers mention hsa-mir-147a | ||||
Stem-loop |
-a caa ug ---aca g 5' aaucua aga cauuuc cacac cca a |||||| ||| |||||| ||||| ||| c 3' uuagau ucu guaaag gugug ggu u cg -uc gu accgaa a |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: not enough data
| ||||
Comments |
Lagos-Quintana et al. cloned miR-147 from mouse spleen tissue [1], but the sequence is not present in the mouse genome assembly (NCBI32). The human genome sequence contains a predicted precursor hairpin for miR-147 shown in [1] (supplementary information) and represented here. The expression of miR-147 has not been verified in human. |
||||
Genome context |
|
||||
Database links |
Mature sequence hsa-miR-147a |
|
Accession | MIMAT0000251 |
Previous IDs | hsa-miR-147 |
Sequence |
47 - guguguggaaaugcuucugc - 66 |
Deep sequencing | 1732 reads, 108 experiments |
Evidence | not experimental |
Predicted targets |
|
References |
|
1 |
PMID:12007417
"Identification of tissue-specific microRNAs from mouse"
Curr Biol. 12:735-739(2002).
|