Stem-loop sequence hsa-mir-30c-2

Accession

MI0000254 (change log)

Previous IDs

hsa-mir-30c

Symbol

HGNC:MIR30C2

Description

Homo sapiens miR-30c-2 stem-loop

Gene family

MIPF0000005; mir-30

Literature search

381 open access papers mention hsa-mir-30c-2
(1856 sentences)

Stem-loop

      uacu       u   aca         guggaa 
5' aga    guaaaca ccu   cucucagcu      a
   |||    ||||||| |||   |||||||||       
3' ucu    cauuugu gga   gagggucga      g
      uucu       c   --a         aagaau 

Deep sequencing

1446793 reads, 3.22e+03 reads per million, 159 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Comments

miR-30c was cloned from mouse heart and brain tissues by Lagos-Quintana et al. [1]. Two human hairpin precursor sequences are predicted based on homology with the mouse sequences, on chromosomes 1 (MI0000736) and 6 (MI0000254) [3]. Expression of miR-30c was later independently verified in human HL-60 leukemia cells [2].

Genome context

• Coordinates (GRCh38; GCA_000001405.15): chr6: 71376960-71377031 [-]
• Overlapping transcripts:

  intergenic

Database links

• EntrezGene:MIR30C2
• HGNC:MIR30C2
• RNAcentral:URS0000137EDE_9606
• miRBase Tracker:MI0000254

Mature sequence hsa-miR-30c-5p

• Accession: MIMAT0000244
• Previous IDs: hsa-miR-30c
• Sequence: 7 - uguaaacauccuacacucucagc - 29
• Deep sequencing: 2809908 reads, 159 experiments
• Evidence: experimental; cloned [2,4-6]
• Database links:
  • RNAcentral:URS000019907A_9606
• Predicted targets:
  • TargetMiner:hsa-miR-30c-5p
  • TargetScanVert:hsa-miR-30c-5p
  • miRDB:hsa-miR-30c-5p
  • microrna.org:hsa-miR-30c-5p

Mature sequence hsa-miR-30c-2-3p

• Accession: MIMAT0004550
• Previous IDs: hsa-miR-30c-2*
• Sequence: 47 - cugggagaaggcuguuuacucu - 68
• Deep sequencing: 41456 reads, 153 experiments
• Evidence: experimental; cloned [5]
• Database links:
  • RNAcentral:URS0000527228_9606
• Predicted targets:
  • TargetMiner:hsa-miR-30c-2-3p
  • TargetScanVert:hsa-miR-30c-2-3p
  • miRDB:hsa-miR-30c-2-3p
  • microrna.org:hsa-miR-30c-2-3p

References

1. PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2. PMID:15325244 "Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells" Kasashima K, Nakamura Y, Kozu T Biochem Biophys Res Commun. 322:403-410(2004).
3. PMID:15634332 "New human and mouse microRNA genes found by homology search" Weber MJ FEBS J. 272:59-73(2005).
4. PMID:15978578 "Identification of human fetal liver miRNAs by a novel method" Fu H, Tie Y, Xu C, Zhang Z, Zhu J, Shi Y, Jiang H, Sun Z, Zheng X FEBS Lett. 579:3849-3854(2005).
5. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
6. PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).