MIR197 is a microRNA that has been detected to change its expression in response to resistance training [PMC8505326]. It is one of several miRNAs that show immediate, 1-hour, 4-hour, and 24-hour changes in expression after a single bout of resistance training [PMC8505326]. MIR197 has been found to be inversely related to PD-L1 expression in acute myeloid leukemia, NSCLC, biliary epithelial cells, hepatocellular carcinoma, and colon cancer [PMC7529545]. It is considered a potential surrogate biomarker for PD-L1 expression in NSCLC [PMC7529545]. MIR197 levels have also been measured in sera using quantitative real-time polymerase chain reaction (PCR) [PMC7414326]. In the context of insulin resistance and glucose homeostasis, there appears to be an inverse correlation between glycemia and hepatic levels of MIR197 [PMC6197154]. MIR197 plays an important role in the maintenance of embryogenic callus in rice [PMC10049443]. In female breast cancer, up-regulation of MIR197 has not been reported so far [PMC2850898]. Changes in the levels of MIR197 have also been associated with metabolic syndrome [PMC8793096]. The DDB2 SNP rs1050244 may interfere with the targeted interaction between miR-133a and MIR197, resulting in upregulation of DDB2 mRNA expression and reduced susceptibility to HCC [PMC9712371]. Gap junction-transferred microRNAs including MIR197 have been shown to reduce cancer cell proliferation and induce dormancy that may lead to bone marrow metastasis relapse [PMC4699086].
C A CA A - a ggcugugc GGGU GAGAGGG GUGGG GGu aag g |||||||| |||| ||||||| ||||| ||| ||| ccgguaCG CCCA CUCUUCC CACUU cca uuc c A C AC c c u
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0000227 |
Description | Homo sapiens hsa-miR-197-3p mature miRNA |
Sequence | 48 - UUCACCACCUUCUCCACCCAGC - 69 |
Evidence |
experimental
cloned [1-3] |
Database links | |
Predicted targets |
Accession | MIMAT0022691 |
Description | Homo sapiens hsa-miR-197-5p mature miRNA |
Sequence | 9 - CGGGUAGAGAGGGCAGUGGGAGG - 31 |
Evidence | not_experimental |
Database links | |
Predicted targets |
|