miRBase entry: hsa-mir-29b-2

Stem-loop hsa-mir-29b-2


Accession
MI0000107
Symbol
HGNC: MIR29B2
Description
Homo sapiens hsa-mir-29b-2 precursor miRNA
Gene family
MIPF0000009; mir-29

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR29B2 is a microRNA that has been implicated in various biological processes and diseases, including cancer. However, there is currently a lack of data on the specific role of MIR29B2 and its host gene MIR29B2CHG in cancer [PMC7859645]. In MDA-MB-231S cells, knockdown of LASP-1 resulted in the upregulation of two key microRNAs, miR29B1 and MIR29B2, which correlated with reduced levels of matrix metalloproteinase 9 (MMP9) [PMC4651668]. In humans, two genes on different chromosomes (MIR29B1 on chromosome 7 and MIR29B2 on chromosome 1) encode two precursors that give rise to mature miR-29b-1 and miR-29b-2 with identical sequences [PMC5643533]. Activation of MIR29B2 has been shown to inhibit the expression of the monocarboxylate transporter 1 (MCT1), leading to a disruption in insulin secretion [PMC7795239]. Differential expression of MIR29B2 has also been observed in late-relapse Hodgkin lymphoma samples compared to early-relapse samples [PMC7667426]. Furthermore, alterations in the expression levels of MIR29B2 have been associated with cancer-related genomic regions [PMC2683874]. Additionally, MIR29B2 has been identified as one of several differentially expressed genes (DEGs) in late-relapse Hodgkin lymphoma samples compared to early-relapse samples [PMC8345394]. Finally, elevated levels of miR-29b family members including MIR29B2 have been observed in a mouse brain endothelial cell line under conditions associated with elevated homocysteine levels [PMC6651274].

Literature search
652 open access papers mention hsa-mir-29b-2
(4396 sentences)

Sequence

344587 reads, 2264 reads per million, 138 experiments
cuucuggaagCUGGUUUCACAUGGUGGCUUAGauuuuuccaucuuuguaucUAGCACCAUUUGAAAUCAGUGUUuuaggag
(((((((((((((((((((.((((((.((.((((..............)))))))))))).)))))))))).)))))))))

Structure
         -          C      G  U    uuuucc 
cuucuggaa gCUGGUUUCA AUGGUG CU AGau      a
||||||||| |||||||||| |||||| || ||||       
gaggauuUU UGACUAAAGU UACCAC GA Ucua      u
         G          U      -  -    uguuuc 


Annotation confidence High
Do you think this miRNA is real?
Comments
This sequence was named mir-102-1 in reference [1]. Human miR-102 is a homologue of mouse miR-29b (MIR:MI0000143) and so has been renamed here for consistency.

Genome context
chr1: 207802443-207802523 [-]
Clustered miRNAs
1 other miRNA is < 10 kb from hsa-mir-29b-2
Name Accession Chromosome Start End Strand Confidence




Disease association
hsa-mir-29b-2 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-29b-3p

Accession MIMAT0000100
Description Homo sapiens hsa-miR-29b-3p mature miRNA
Sequence 52 - UAGCACCAUUUGAAAUCAGUGUU - 74
Evidence experimental
cloned [1-4], Northern [2]
Database links
Predicted targets

Mature hsa-miR-29b-2-5p

Accession MIMAT0004515
Description Homo sapiens hsa-miR-29b-2-5p mature miRNA
Sequence 11 - CUGGUUUCACAUGGUGGCUUAG - 32
Evidence experimental
cloned [3]
Database links
Predicted targets

References

  1. PubMed ID: 15183728
    Human embryonic stem cells express a unique set of microRNAs
    "Suh MR, Lee Y, Kim JY, Kim SK, Moon SH, Lee JY, Cha KY, Chung HM, Yoon HS, Moon SY, Kim VN, Kim KS"
    "Dev Biol (2004) 270:488-498

  2. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  3. PubMed ID: 17616659
    Patterns of known and novel small RNAs in human cervical cancer
    "Lui WO, Pourmand N, Patterson BK, Fire A"
    "Cancer Res (2007) 67:6031-6043

  4. PubMed ID: 11914277
    miRNPs: a novel class of ribonucleoproteins containing numerous microRNAs
    "Mourelatos Z, Dostie J, Paushkin S, Sharma A, Charroux B, Abel L, Rappsilber J, Mann M, Dreyfuss G"
    "Genes Dev (2002) 16:720-728