Stem-loop sequence hsa-mir-31

Accession

MI0000089 (change log)

Symbol

HGNC:MIR31

Description

Homo sapiens miR-31 stem-loop

Gene family

MIPF0000064; mir-31

Literature search

385 open access papers mention hsa-mir-31
(2755 sentences)

Stem-loop

         ga     g   c         -u   gaa 
5' ggagag  ggcaa aug uggcauagc  guu   c
   ||||||  ||||| ||| |||||||||  |||    
3' ccuuuc  ccguu uac accguaucg  caa   u
         ua     a   a         uc   ggg 

Deep sequencing

120762 reads, 1.26e+03 reads per million, 157 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. The 5' end of the miRNA may be offset with respect to previous annotations.

Genome context

• Coordinates (GRCh38; GCA_000001405.15): chr9: 21512115-21512185 [-]
• Overlapping transcripts:

  sense

  OTTHUMT00000051910 ; RP11-354P17.9-001; intron 1

  ENST00000304425 ; MIR31HG-001; intron 1

  ENST00000362307 ; MIR31-201; exon 1

Database links

• EntrezGene:MIR31
• HGNC:MIR31
• RNAcentral:URS0000001EB3_9606
• miRBase Tracker:MI0000089

Mature sequence hsa-miR-31-5p

• Accession: MIMAT0000089
• Previous IDs: hsa-miR-31
• Sequence: 8 - aggcaagaugcuggcauagcu - 28
• Deep sequencing: 114253 reads, 156 experiments
• Evidence: experimental; cloned [1-3], Northern [1]
• Database links:
  • RNAcentral:URS00005416E3_9606
• Predicted targets:
  • TargetMiner:hsa-miR-31-5p
  • TargetScanVert:hsa-miR-31-5p
  • miRDB:hsa-miR-31-5p
  • microrna.org:hsa-miR-31-5p

Mature sequence hsa-miR-31-3p

• Accession: MIMAT0004504
• Previous IDs: hsa-miR-31*
• Sequence: 44 - ugcuaugccaacauauugccau - 65
• Deep sequencing: 6497 reads, 130 experiments
• Evidence: experimental; cloned [2]
• Database links:
  • RNAcentral:URS00002A291B_9606
• Predicted targets:
  • TargetMiner:hsa-miR-31-3p
  • TargetScanVert:hsa-miR-31-3p
  • miRDB:hsa-miR-31-3p
  • microrna.org:hsa-miR-31-3p

References

1. PMID:11679670 "Identification of novel genes coding for small expressed RNAs" Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T Science. 294:853-858(2001).
2. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3. PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).