Stem-loop sequence hsa-mir-28

Accession

MI0000086 (change log)

Symbol

HGNC:MIR28

Description

Homo sapiens miR-28 stem-loop

Gene family

MIPF0000057; mir-28

Literature search

90 open access papers mention hsa-mir-28
(306 sentences)

Stem-loop

      c         a                u  ----     cc 
5' ggu cuugcccuc aggagcucacagucua ug    aguua  u
   ||| ||||||||| |||||||||||||||| ||    |||||   
3' uca ggacgggag uccucgaguguuagau ac    ucagu  u
      c         g                c  ccuu     cu 

Deep sequencing

1014897 reads, 3.61e+03 reads per million, 160 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (GRCh38; GCA_000001405.15): chr3: 188688781-188688866 [+]
• Overlapping transcripts:

  sense

  OTTHUMT00000343932 ; TPRG1-002; intron 1

  ENST00000433971 ; TPRG1-002; intron 1

Database links

• EntrezGene:MIR28
• HGNC:MIR28
• RNAcentral:URS000048B329_9606
• miRBase Tracker:MI0000086

Mature sequence hsa-miR-28-5p

• Accession: MIMAT0000085
• Previous IDs: hsa-miR-28
• Sequence: 14 - aaggagcucacagucuauugag - 35
• Deep sequencing: 696356 reads, 159 experiments
• Evidence: experimental; cloned [1-3], Northern [1]
• Database links:
  • RNAcentral:URS00003E47B1_9606
• Predicted targets:
  • TargetMiner:hsa-miR-28-5p
  • TargetScanVert:hsa-miR-28-5p
  • miRDB:hsa-miR-28-5p
  • microrna.org:hsa-miR-28-5p

Mature sequence hsa-miR-28-3p

• Accession: MIMAT0004502
• Sequence: 54 - cacuagauugugagcuccugga - 75
• Deep sequencing: 318531 reads, 160 experiments
• Evidence: experimental; cloned [2-4]
• Database links:
  • RNAcentral:URS00001799A3_9606
• Predicted targets:
  • TargetMiner:hsa-miR-28-3p
  • TargetScanVert:hsa-miR-28-3p
  • miRDB:hsa-miR-28-3p
  • microrna.org:hsa-miR-28-3p

References

1. PMID:11679670 "Identification of novel genes coding for small expressed RNAs" Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T Science. 294:853-858(2001).
2. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3. PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).
4. PMID:18230126 "New miRNAs cloned from neuroblastoma" Afanasyeva EA, Hotz-Wagenblatt A, Glatting KH, Westermann F BMC Genomics. 9:52(2008).