Stem-loop sequence hsa-mir-21

AccessionMI0000077 (change log)
Symbol HGNC:MIR21
DescriptionHomo sapiens miR-21 stem-loop
Gene family MIPF0000060; mir-21
Literature search

1559 open access papers mention hsa-mir-21
(12920 sentences)

Stem-loop 
   u     gu        a     a     a    u a 
5'  gucgg  agcuuauc gacug uguug cugu g a
    |||||  |||||||| ||||| ||||| |||| | u
3'  caguc  ucggguag cugac acaac ggua c c
   a     ug        -     c     -    - u
Get sequence
Deep sequencing
31157639 reads, 9.94e+04 reads per million, 159 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

Mourelatos et al. named this sequence miR-21 precursor-17 and also reported the exact reverse complement of this predicted stem-loop sequence and erroneously assigned the name miR-104 [2].

Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr17: 59841266-59841337 [+]
antisense
OTTHUMT00000445364 ; BRIP1-006; intron 1
OTTHUMT00000445363 ; BRIP1-002; intron 13
OTTHUMT00000445362 ; BRIP1-001; intron 14
ENST00000584322 ; BRIP1-006; intron 1
ENST00000577598 ; BRIP1-002; intron 13
ENST00000259008 ; BRIP1-001; intron 14
Database links

Mature sequence hsa-miR-21-5p

Accession MIMAT0000076
Previous IDshsa-miR-21
Sequence

8 -  

uagcuuaucagacugauguuga

 - 29

Get sequence
Deep sequencing31088727 reads, 159 experiments
Evidence experimental; cloned [1-3,6-9], Northern [1,5], Illumina [10]
Database links
Predicted targets

Mature sequence hsa-miR-21-3p

Accession MIMAT0004494
Previous IDshsa-miR-21*
Sequence

46 -  

caacaccagucgaugggcugu

 - 66

Get sequence
Deep sequencing68855 reads, 157 experiments
Evidence experimental; cloned [8-9]
Database links
Predicted targets

References

1
PMID:11679670 "Identification of novel genes coding for small expressed RNAs" Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T Science. 294:853-858(2001).
2
PMID:11914277 "miRNPs: a novel class of ribonucleoproteins containing numerous microRNAs" Mourelatos Z, Dostie J, Paushkin S, Sharma A, Charroux B, Abel L, Rappsilber J, Mann M, Dreyfuss G Genes Dev. 16:720-728(2002).
3
PMID:14573789 "Reduced accumulation of specific microRNAs in colorectal neoplasia" Michael MZ, O' Connor SM, van Holst Pellekaan NG, Young GP, James RJ Mol Cancer Res. 1:882-891(2003).
4
PMID:12554860 "Numerous microRNPs in neuronal cells containing novel microRNAs" Dostie J, Mourelatos Z, Yang M, Sharma A, Dreyfuss G RNA. 9:180-186(2003).
5
PMID:15183728 "Human embryonic stem cells express a unique set of microRNAs" Suh MR, Lee Y, Kim JY, Kim SK, Moon SH, Lee JY, Cha KY, Chung HM, Yoon HS, Moon SY, Kim VN, Kim KS Dev Biol. 270:488-498(2004).
6
PMID:15325244 "Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells" Kasashima K, Nakamura Y, Kozu T Biochem Biophys Res Commun. 322:403-410(2004).
7
PMID:15978578 "Identification of human fetal liver miRNAs by a novel method" Fu H, Tie Y, Xu C, Zhang Z, Zhu J, Shi Y, Jiang H, Sun Z, Zheng X FEBS Lett. 579:3849-3854(2005).
8
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
9
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).
10
PMID:20158877 "Analysis of deep sequencing microRNA expression profile from human embryonic stem cells derived mesenchymal stem cells reveals possible role of let-7 microRNA family in downstream targeting of hepatic nuclear factor 4 alpha" Koh W, Sheng CT, Tan B, Lee QY, Kuznetsov V, Kiang LS, Tanavde V BMC Genomics. 11 Suppl 1:S6(2010).