Stem-loop sequence hsa-mir-19b-2

Accession

MI0000075 (change log)

Symbol

HGNC:MIR19B2

Description

Homo sapiens miR-19b-2 stem-loop

Gene family

MIPF0000011; mir-19

Literature search

282 open access papers mention hsa-mir-19b-2
(1227 sentences)

Stem-loop

         cuac                 -  -       uuca       u 
5' acauug    uuacaauuaguuuugca gg uuugcau    gcguaua a
   ||||||    ||||||||||||||||| || |||||||    |||||||  
3' uguaau    aguguuagucaaaacgu cc aaacgug    uguauau u
         ----                 a  u       ucgg       g 

Deep sequencing

2018012 reads, 1.18e+04 reads per million, 160 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (GRCh38; GCA_000001405.15): chrX: 134169671-134169766 [-]
• Overlapping transcripts:

  intergenic

Clustered miRNAs

< 10kb from hsa-mir-19b-2

• hsa-mir-106a: chrX: 134170198-134170278 [-]
• hsa-mir-18b: chrX: 134170041-134170111 [-]
• hsa-mir-20b: chrX: 134169809-134169877 [-]
• hsa-mir-19b-2: chrX: 134169671-134169766 [-]
• hsa-mir-92a-2: chrX: 134169538-134169612 [-]
• hsa-mir-363: chrX: 134169378-134169452 [-]

Database links

• EntrezGene:MIR19B2
• HGNC:MIR19B2
• RNAcentral:URS0000204276_9606
• miRBase Tracker:MI0000075

Mature sequence hsa-miR-19b-2-5p

• Accession: MIMAT0004492
• Previous IDs: hsa-miR-19b-2*
• Sequence: 19 - aguuuugcagguuugcauuuca - 40
• Deep sequencing: 16076 reads, 89 experiments
• Evidence: experimental; cloned [8]
• Predicted targets:
  • TargetMiner:hsa-miR-19b-2-5p
  • TargetScanVert:hsa-miR-19b-2-5p
  • miRDB:hsa-miR-19b-2-5p
  • microrna.org:hsa-miR-19b-2-5p

Mature sequence hsa-miR-19b-3p

• Accession: MIMAT0000074
• Previous IDs: hsa-miR-19b
• Sequence: 62 - ugugcaaauccaugcaaaacuga - 84
• Deep sequencing: 3890764 reads, 159 experiments
• Evidence: experimental; cloned [1-3,6-9], Northern [1,5]
• Database links:
  • RNAcentral:URS000013D17D_9606
• Predicted targets:
  • TargetMiner:hsa-miR-19b-3p
  • TargetScanVert:hsa-miR-19b-3p
  • miRDB:hsa-miR-19b-3p
  • microrna.org:hsa-miR-19b-3p

References

1. PMID:11679670 "Identification of novel genes coding for small expressed RNAs" Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T Science. 294:853-858(2001).
2. PMID:11914277 "miRNPs: a novel class of ribonucleoproteins containing numerous microRNAs" Mourelatos Z, Dostie J, Paushkin S, Sharma A, Charroux B, Abel L, Rappsilber J, Mann M, Dreyfuss G Genes Dev. 16:720-728(2002).
3. PMID:14573789 "Reduced accumulation of specific microRNAs in colorectal neoplasia" Michael MZ, O' Connor SM, van Holst Pellekaan NG, Young GP, James RJ Mol Cancer Res. 1:882-891(2003).
4. PMID:12554860 "Numerous microRNPs in neuronal cells containing novel microRNAs" Dostie J, Mourelatos Z, Yang M, Sharma A, Dreyfuss G RNA. 9:180-186(2003).
5. PMID:15183728 "Human embryonic stem cells express a unique set of microRNAs" Suh MR, Lee Y, Kim JY, Kim SK, Moon SH, Lee JY, Cha KY, Chung HM, Yoon HS, Moon SY, Kim VN, Kim KS Dev Biol. 270:488-498(2004).
6. PMID:15325244 "Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells" Kasashima K, Nakamura Y, Kozu T Biochem Biophys Res Commun. 322:403-410(2004).
7. PMID:15978578 "Identification of human fetal liver miRNAs by a novel method" Fu H, Tie Y, Xu C, Zhang Z, Zhu J, Shi Y, Jiang H, Sun Z, Zheng X FEBS Lett. 579:3849-3854(2005).
8. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
9. PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).