miRBase entry: hsa-let-7f-1

Stem-loop hsa-let-7f-1


Accession
MI0000067
Symbol
HGNC: MIRLET7F1
Description
Homo sapiens hsa-let-7f-1 precursor miRNA
Gene family
MIPF0000002; let-7

Literature search
1093 open access papers mention hsa-let-7f-1
(6143 sentences)

Sequence

24889328 reads, 65280 reads per million, 158 experiments
ucagagUGAGGUAGUAGAUUGUAUAGUUgugggguagugauuuuacccuguucaggagauaaCUAUACAAUCUAUUGCCUUCCCuga
((((.(.((((((((((((((((((((((((((((((.....))))))).........))))))))))))))))))))))).)))))

Structure
    a U                       ---------       u 
ucag g GAGGUAGUAGAUUGUAUAGUUgu         gggguag g
|||| | |||||||||||||||||||||||         ||||||| a
aguC C UUCCGUUAUCUAACAUAUCaaua         ucccauu u
    - C                       gaggacuug       u 


Annotation confidence High
Do you think this miRNA is real?

Genome context
chr9: 94176347-94176433 [+]
Clustered miRNAs
2 other miRNAs are < 10 kb from hsa-let-7f-1
Name Accession Chromosome Start End Strand Confidence




Disease association
hsa-let-7f-1 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-let-7f-5p

Accession MIMAT0000067
Description Homo sapiens hsa-let-7f-5p mature miRNA
Sequence 7 - UGAGGUAGUAGAUUGUAUAGUU - 28
Evidence experimental
cloned [1,3-5], Northern [1], Illumina [6]
Database links
Predicted targets

Mature hsa-let-7f-1-3p

Accession MIMAT0004486
Description Homo sapiens hsa-let-7f-1-3p mature miRNA
Sequence 63 - CUAUACAAUCUAUUGCCUUCCC - 84
Evidence experimental
cloned [4]
Database links
Predicted targets

References

  1. PubMed ID: 11679670
    Identification of novel genes coding for small expressed RNAs
    "Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T"
    "Science (2001) 294:853-858

  2. PubMed ID: 14573789
    Reduced accumulation of specific microRNAs in colorectal neoplasia
    "Michael MZ, O' Connor SM, van Holst Pellekaan NG, Young GP, James RJ"
    "Mol Cancer Res (2003) 1:882-891

  3. PubMed ID: 15325244
    Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells
    "Kasashima K, Nakamura Y, Kozu T"
    "Biochem Biophys Res Commun (2004) 322:403-410

  4. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  5. PubMed ID: 17616659
    Patterns of known and novel small RNAs in human cervical cancer
    "Lui WO, Pourmand N, Patterson BK, Fire A"
    "Cancer Res (2007) 67:6031-6043

  6. PubMed ID: 20158877
    Analysis of deep sequencing microRNA expression profile from human embryonic stem cells derived mesenchymal stem cells reveals possible role of let-7 microRNA family in downstream targeting of hepatic nuclear factor 4 alpha
    Koh W, Sheng CT, Tan B, Lee QY, Kuznetsov V, Kiang LS, Tanavde V
    BMC Genomics (2010) 11:S6