miRBase entry: hsa-let-7d

Stem-loop hsa-let-7d


Accession
MI0000065
Symbol
HGNC: MIRLET7D
Description
Homo sapiens hsa-let-7d precursor miRNA
Gene family
MIPF0000002; let-7

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIRLET7D is a multicomponent RNA-protein complex that plays a crucial role in nucleolar organization [PMC9455804]. It specifically interacts with non-coding RNAs (ncRNAs) and not messenger RNAs (mRNAs) [PMC6527704]. In human primary lung fibroblasts, the loss of MIRLET7D, as well as the downregulation of EXOSC10 and EZH2, leads to increased cell migration [PMC6527704'>PMC6527704]. This decrease in MIRLET7D levels is associated with elevated expression of MIRLET7D targets and fibrosis markers [PMC6527704]. Biotinylated MIRCTRL and MIRLET7D were transfected to study their effects at a concentration of 20 nM [PMC6527704]. Mutations in MIRLET7D have been observed, including hotspot indels mutations in the upstream flanking sequence [PMC9708458]. In an experimental system, alterations in MIRLET7D and Cited2 were found to be involved in chromatin remodeling [PMC9059753]. The promoters of MIRLET7D targets were analyzed using chromatin immunoprecipitation (ChIP) with antibodies specific for acetylated H3K27 or trimethylated H3K27, revealing the sequential order of events after transfection with MIRCTRL or MIRLET7D alone or in combination with shRNAs specific for HDAC1 [PMC6527704].

References:
- PMC9455804
- PMC6527704
- PMC9708458
- PMC9059753

Literature search
1090 open access papers mention hsa-let-7d
(6011 sentences)

Sequence

1103859 reads, 4366 reads per million, 145 experiments
ccuaggaAGAGGUAGUAGGUUGCAUAGUUuuagggcagggauuuugcccacaaggagguaaCUAUACGACCUGCUGCCUUUCUuagg
(((((((.((((((((((((((.((((((...((((((.....))))))..........)))))).)))))))))))))))))))))

Structure
       A              C      -------uua      g 
ccuagga GAGGUAGUAGGUUG AUAGUU          gggcag g
||||||| |||||||||||||| ||||||          |||||| a
ggauUCU UUCCGUCGUCCAGC UAUCaa          cccguu u
       -              A      uggaggaaca      u 


Annotation confidence High
Do you think this miRNA is real?
Comments
The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3].

Genome context
chr9: 94178834-94178920 [+]
Clustered miRNAs
2 other miRNAs are < 10 kb from hsa-let-7d
Name Accession Chromosome Start End Strand Confidence




Disease association
hsa-let-7d is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-let-7d-5p

Accession MIMAT0000065
Description Homo sapiens hsa-let-7d-5p mature miRNA
Sequence 8 - AGAGGUAGUAGGUUGCAUAGUU - 29
Evidence experimental
cloned [1-4], Northern [1], Illumina [5]
Database links
Predicted targets

Mature hsa-let-7d-3p

Accession MIMAT0004484
Description Homo sapiens hsa-let-7d-3p mature miRNA
Sequence 62 - CUAUACGACCUGCUGCCUUUCU - 83
Evidence experimental
cloned [3]
Database links
Predicted targets

References

  1. PubMed ID: 11679670
    Identification of novel genes coding for small expressed RNAs
    "Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T"
    "Science (2001) 294:853-858

  2. PubMed ID: 15325244
    Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells
    "Kasashima K, Nakamura Y, Kozu T"
    "Biochem Biophys Res Commun (2004) 322:403-410

  3. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  4. PubMed ID: 17616659
    Patterns of known and novel small RNAs in human cervical cancer
    "Lui WO, Pourmand N, Patterson BK, Fire A"
    "Cancer Res (2007) 67:6031-6043

  5. PubMed ID: 20158877
    Analysis of deep sequencing microRNA expression profile from human embryonic stem cells derived mesenchymal stem cells reveals possible role of let-7 microRNA family in downstream targeting of hepatic nuclear factor 4 alpha
    Koh W, Sheng CT, Tan B, Lee QY, Kuznetsov V, Kiang LS, Tanavde V
    BMC Genomics (2010) 11:S6