Mature sequence bta-miR-1949

Accession numberMIMAT0046755
IDbta-miR-1949
Stem-Loop bta-mir-1949
Sequence
uauaccaggaugccagcauaguu
Get sequence
Deep sequencing22 reads, 17 experiments

References

1
PMID:26519053 "Deep sequencing shows microRNA involvement in bovine mammary gland adaptation to diets supplemented with linseed oil or safflower oil" Li R, Beaudoin F, Ammah AA, Bissonnette N, Benchaar C, Zhao X, Lei C, Ibeagha-Awemu EM BMC Genomics. 16:884(2015).