Mature sequence bta-miR-12004

Accession numberMIMAT0046664
IDbta-miR-12004
Stem-Loop bta-mir-12004
Sequence
cuggcucuggcucucugccuccu
Get sequence
Deep sequencing18 reads, 13 experiments

References

1
PMID:26519053 "Deep sequencing shows microRNA involvement in bovine mammary gland adaptation to diets supplemented with linseed oil or safflower oil" Li R, Beaudoin F, Ammah AA, Bissonnette N, Benchaar C, Zhao X, Lei C, Ibeagha-Awemu EM BMC Genomics. 16:884(2015).