Mature sequence pte-miR-11942b-5p

Accession numberMIMAT0046256
IDpte-miR-11942b-5p
Stem-Loop pte-mir-11942b
Sequence
ugcuaagacugucaguguuugg
Get sequence
Deep sequencing reads, experiments

References

1
PMID:27324919 "Pervasive microRNA Duplication in Chelicerates: Insights from the Embryonic microRNA Repertoire of the Spider Parasteatoda tepidariorum" Leite DJ, Ninova M, Hilbrant M, Arif S, Griffiths-Jones S, Ronshaugen M, McGregor AP Genome Biol Evol. 8:2133-2144(2016).