Mature sequence bdo-miR-2a

Accession numberMIMAT0045403
IDbdo-miR-2a
Stem-Loop bdo-mir-2a-1
Sequence
uaucacagccagcuuugaugagcu
Get sequence
Deep sequencing reads, experiments

References

1