Mature sequence dre-miR-725-5p

Accession numberMIMAT0032010
IDdre-miR-725-5p
Stem-Loop dre-mir-725 dre-mir-725-2
Sequence
ugcuaggaaugguggcugagau
Get sequence
Deep sequencing577 reads, 11 experiments

References

1
PMID:16698962 "Cloning and expression of new microRNAs from zebrafish" Kloosterman WP, Steiner FA, Berezikov E, de Bruijn E, van de Belt J, Verheul M, Cuppen E, Plasterk RH Nucleic Acids Res. 34:2558-2569(2006).