Mature sequence bta-miR-378b

Accession numberMIMAT0025535
IDbta-miR-378b
Stem-Loop bta-mir-378b
Sequence
acuugacuuggagucagaaggc
Get sequence
Deep sequencing742440 reads, 78 experiments
Predicted targets

References

1
PMID:21912509 "Solexa sequencing of novel and differentially expressed microRNAs in testicular and ovarian tissues in Holstein cattle" Huang J, Ju Z, Li Q, Hou Q, Wang C, Li J, Li R, Wang L, Sun T, Hang S, Gao Y, Hou M, Zhong J Int J Biol Sci. 7:1016-1026(2011).