miRBase entry: bta-mir-378b

Stem-loop bta-mir-378b


Accession
MI0022279
Description
Bos taurus bta-mir-378b precursor miRNA

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

Bta-mir-378b, a member of the miR-378 gene family, is implicated in regulating lipogenesis in adipose tissues and is down-regulated in multiple intestinal regions of super-shedders (SS), suggesting a role in altering lipid metabolism and immune functions, potentially affecting E. coli O157 interactions [PMC7959717]. This miRNA's down-regulation correlates with the negative regulation of PRDM1 and CYLD transcripts, which are associated with immune responses [PMC7959717]. The breadth of bta-mir-378b's influence is evident as it is down-regulated across all intestinal regions examined in SS cattle, with a varying number of negatively correlated transcripts ranging from two to 38 [PMC7959717]. The down-regulation pattern suggests bta-mir-378b may influence the expression of genes involved in immune defenses potentially affected by translocation of Gram-negative bacteria [PMC7959717]. Furthermore, bta-mir-378b's role as a key regulator is underscored by its consistent down-regulation across all intestinal regions studied and its association with differentially expressed genes between non-shedders (NS) and SS cattle [PMC7959717].

Literature search
24 open access papers mention bta-mir-378b
(101 sentences)

Sequence

914 reads, 109 reads per million, 67 experiments
cuggaccaccagggaaauccugauuuuguuucuuauuaaggggagguucaguauagagcaaacagcACUUGACUUGGAGUCAGAAGGCuuagguccaa
.((((((..((((.....)))).(((((((((...((((((....((((......))))......).)))))...)))).)))))......)))))).

Structure
c      accagggaaauccuga     -    uua     - --ggag    ag 
 uggacc                uuuug uuuc   uuaag g      guuc  u
 ||||||                ||||| ||||   ||||| |      ||||   
 accugg                AAGAC GAGG   AGUUC c      cgag  a
a      ----------auuCGG     U    UUC     A gacaaa    au 


Annotation confidence Low
Do you think this miRNA is real?

Genome context
chr15: 30904740-30904837 [+]

Database links

Mature bta-miR-378b

Accession MIMAT0025535
Description Bos taurus bta-miR-378b mature miRNA
Sequence 67 - ACUUGACUUGGAGUCAGAAGGC - 88
Evidence experimental
Illumina [1]

References

  1. PubMed ID: 21912509
    Solexa sequencing of novel and differentially expressed microRNAs in testicular and ovarian tissues in Holstein cattle
    "Huang J, Ju Z, Li Q, Hou Q, Wang C, Li J, Li R, Wang L, Sun T, Hang S, Gao Y, Hou M, Zhong J"
    "Int J Biol Sci (2011) 7:1016-1026