Mature sequence hsa-miR-548aj-3p

Accession numberMIMAT0018990
IDhsa-miR-548aj-3p
Previous IDshsa-miR-548aj
Stem-Loop hsa-mir-548aj-1 hsa-mir-548aj-2
Sequence
uaaaaacugcaauuacuuuua
Get sequence
Deep sequencing4677 reads, 100 experiments
Predicted targets

References

1
PMID:20733160 "Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs" Jima DD, Zhang J, Jacobs C, Richards KL, Dunphy CH, Choi WW, Au WY, Srivastava G, Czader MB, Rizzieri DA, Lagoo AS, Lugar PL, Mann KP, Flowers CR, Bernal-Mizrachi L, Naresh KN, Evens AM, Gordon LI, Luftig M, Friedman DR, Weinberg JB, Thompson MA, Gill JI, Blood. 116:e118-e127(2010).