Mature sequence gma-miR1520p

Accession numberMIMAT0018322
IDgma-miR1520p
Stem-Loop gma-MIR1520p
Sequence
auguuguuauuggaugaugacggu
Get sequence
Deep sequencing reads, experiments

References

1
PMID:20122185 "Prediction of novel miRNAs and associated target genes in Glycine max" Joshi T, Yan Z, Libault M, Jeong DH, Park S, Green PJ, Sherrier DJ, Farmer A, May G, Meyers BC, Xu D, Stacey G BMC Bioinformatics. 11 Suppl 1:S14(2010).