Mature sequence gma-miR1520r

Accession numberMIMAT0018313
IDgma-miR1520r
Stem-Loop gma-MIR1520r
Sequence
ugucacauccugguuggacaugaa
Get sequence
Deep sequencing reads, experiments

References

1
PMID:20122185 "Prediction of novel miRNAs and associated target genes in Glycine max" Joshi T, Yan Z, Libault M, Jeong DH, Park S, Green PJ, Sherrier DJ, Farmer A, May G, Meyers BC, Xu D, Stacey G BMC Bioinformatics. 11 Suppl 1:S14(2010).