Mature sequence gma-miR4394

Accession numberMIMAT0018309
IDgma-miR4394
Stem-Loop gma-MIR4394
Sequence
aauggacuaaagagaaaggggccg
Get sequence
Deep sequencing reads, experiments

References

1
PMID:20122185 "Prediction of novel miRNAs and associated target genes in Glycine max" Joshi T, Yan Z, Libault M, Jeong DH, Park S, Green PJ, Sherrier DJ, Farmer A, May G, Meyers BC, Xu D, Stacey G BMC Bioinformatics. 11 Suppl 1:S14(2010).