Mature sequence gma-miR4389

Accession numberMIMAT0018302
IDgma-miR4389
Stem-Loop gma-MIR4389
Sequence
ucggucggaccgauccaaucggaa
Get sequence
Deep sequencing reads, experiments

References

1
PMID:20122185 "Prediction of novel miRNAs and associated target genes in Glycine max" Joshi T, Yan Z, Libault M, Jeong DH, Park S, Green PJ, Sherrier DJ, Farmer A, May G, Meyers BC, Xu D, Stacey G BMC Bioinformatics. 11 Suppl 1:S14(2010).