Mature sequence gma-miR1520m

Accession numberMIMAT0018293
IDgma-miR1520m
Stem-Loop gma-MIR1520m
Sequence
aaucagaacaugacaugugacaau
Get sequence
Deep sequencing reads, experiments

References

1
PMID:20122185 "Prediction of novel miRNAs and associated target genes in Glycine max" Joshi T, Yan Z, Libault M, Jeong DH, Park S, Green PJ, Sherrier DJ, Farmer A, May G, Meyers BC, Xu D, Stacey G BMC Bioinformatics. 11 Suppl 1:S14(2010).