Mature sequence zma-miR169c-3p

Accession numberMIMAT0015193
IDzma-miR169c-3p
Previous IDszma-miR169c*
Stem-Loop zma-MIR169c
Sequence
ggcaagucuguccuuggcuaca
Get sequence
Deep sequencing1985 reads, 199 experiments
Database links
QuickGO function

References

1
"Conservation and divergence of microRNA families in plants" Dezulian T, Palatnik JF, Huson DH, Weigel D http://genomebiology.com/2005/6/11/p13 (2005).
2
PMID:15916721 "Identification and characterization of new plant microRNAs using EST analysis" Zhang BH, Pan XP, Wang QL, Cobb GP, Anderson TA Cell Res. 15:336-360(2005).
3
PMID:19936050 "A genome-wide characterization of microRNA genes in maize" Zhang L, Chia JM, Kumari S, Stein JC, Liu Z, Narechania A, Maher CA, Guill K, McMullen MD, Ware D PLoS Genet. 5:e1000716(2009).