Mature sequence eca-miR-221

Accession numberMIMAT0013203
IDeca-miR-221
Stem-Loop eca-mir-221
Sequence
agcuacauugucugcuggguuuc
Get sequence
Deep sequencing846 reads, 1 experiments

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).