Mature sequence sbi-miR395l

Accession numberMIMAT0011356
IDsbi-miR395l
Stem-Loop sbi-MIR395l
Sequence
gugaagugcuugggggaacuc
Get sequence
Deep sequencing reads, experiments

References

1
PMID:19189423 "The Sorghum bicolor genome and the diversification of grasses" Paterson AH, Bowers JE, Bruggmann R, Dubchak I, Grimwood J, Gundlach H, Haberer G, Hellsten U, Mitros T, Poliakov A, Schmutz J, Spannagl M, Tang H, Wang X, Wicker T, Bharti AK, Chapman J, Feltus FA, Gowik U, Grigoriev IV, Lyons E, Maher CA, Martis M, Nare Nature. 457:551-556(2009).