Mature sequence sbi-miR395c

Accession numberMIMAT0011350
IDsbi-miR395c
Stem-Loop sbi-MIR395c
Sequence
gugaaguguuugggggaacuc
Get sequence
Deep sequencing reads, experiments

References

1
PMID:19189423 "The Sorghum bicolor genome and the diversification of grasses" Paterson AH, Bowers JE, Bruggmann R, Dubchak I, Grimwood J, Gundlach H, Haberer G, Hellsten U, Mitros T, Poliakov A, Schmutz J, Spannagl M, Tang H, Wang X, Wicker T, Bharti AK, Chapman J, Feltus FA, Gowik U, Grigoriev IV, Lyons E, Maher CA, Martis M, Nare Nature. 457:551-556(2009).