Mature sequence mtr-miR156e

Accession numberMIMAT0011081
IDmtr-miR156e
Stem-Loop mtr-MIR156e
Sequence
uugacagaagauagagagcac
Get sequence
Deep sequencing reads, experiments

References

1
" Bonnet E Unpublished (2007).
2
PMID:19555436 "Cloning and characterization of small RNAs from Medicago truncatula reveals four novel legume-specific microRNA families" Jagadeeswaran G, Zheng Y, Li YF, Shukla LI, Matts J, Hoyt P, Macmil SL, Wiley GB, Roe BA, Zhang W, Sunkar R New Phytol. 184:85-98(2009).