Mature sequence osa-miR2104

Accession numberMIMAT0010072
IDosa-miR2104
Stem-Loop osa-MIR2104
Sequence
gcggcgaggggaugcgagcgug
Get sequence
Deep sequencing reads, experiments

References

1
PMID:19103661 "Characterization and expression profiles of miRNAs in rice seeds" Xue LJ, Zhang JJ, Xue HW Nucleic Acids Res. 37:916-930(2009).