Mature sequence hsa-miR-1197

Accession numberMIMAT0005955
IDhsa-miR-1197
Stem-Loop hsa-mir-1197
Sequence
uaggacacauggucuacuucu
Get sequence
Deep sequencing252 reads, 71 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:18230126 "New miRNAs cloned from neuroblastoma" Afanasyeva EA, Hotz-Wagenblatt A, Glatting KH, Westermann F BMC Genomics. 9:52(2008).