Mature sequence hsa-miR-548k

Accession numberMIMAT0005882
IDhsa-miR-548k
Stem-Loop hsa-mir-548k
Sequence
aaaaguacuugcggauuuugcu
Get sequence
Deep sequencing7154 reads, 142 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:18285502 "Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells" Morin RD, O'Connor MD, Griffith M, Kuchenbauer F, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Eaves CJ, Marra MA Genome Res. 18:610-621(2008).