Mature sequence cel-miR-1019-3p

• Accession number: MIMAT0005032
• ID: cel-miR-1019-3p
• Previous IDs: cel-miR-1019
• Stem-Loop: cel-mir-1019
• Sequence: cuguaauuccacauugcuuuccag
• Deep sequencing: reads, experiments
• Predicted targets:
  • TargetScanWorm:cel-miR-1019
  • microrna.org:cel-miR-1019-3p

References

1. PMID:17589500 "Intronic microRNA precursors that bypass Drosha processing" Ruby JG, Jan CH, Bartel DP Nature. 448:83-86(2007).
2. PMID:18042455 "Systematic identification of C. elegans miRISC proteins, miRNAs, and mRNA targets by their interactions with GW182 proteins AIN-1 and AIN-2" Zhang L, Ding L, Cheung TH, Dong MQ, Chen J, Sewell AK, Liu X, Yates JR 3rd, Han M Mol Cell. 28:598-613(2007).