Mature sequence cel-miR-1019-3p

Accession numberMIMAT0005032
IDcel-miR-1019-3p
Previous IDscel-miR-1019
Stem-Loop cel-mir-1019
Sequence
cuguaauuccacauugcuuuccag
Get sequence
Deep sequencing reads, experiments
Predicted targets

References

1
PMID:17589500 "Intronic microRNA precursors that bypass Drosha processing" Ruby JG, Jan CH, Bartel DP Nature. 448:83-86(2007).
2
PMID:18042455 "Systematic identification of C. elegans miRISC proteins, miRNAs, and mRNA targets by their interactions with GW182 proteins AIN-1 and AIN-2" Zhang L, Ding L, Cheung TH, Dong MQ, Chen J, Sewell AK, Liu X, Yates JR 3rd, Han M Mol Cell. 28:598-613(2007).