Accession | MIMAT0004926 |
Description | hsa-miR-708-5p mature miRNA |
Hairpins | |
Sequence | AAGGAGCUUACAAUCUAGCUGGG |
Evidence |
experimental
cloned [1-2] |
Database links | |
Predicted targets |
QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.
Qualifier | GO term | Evidence | Reference | Annotation Extension |
---|---|---|---|---|
acts_upstream_of | GO:0032691 negative regulation of interleukin-1 beta production |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:31599428 | occurs_in CL:0000235 |
acts_upstream_of | GO:0032715 negative regulation of interleukin-6 production |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:31599428 | occurs_in CL:0000235 |
acts_upstream_of | GO:0032720 negative regulation of tumor necrosis factor production |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:31599428 | occurs_in CL:0000235 |
enables | GO:0003730 mRNA 3'-UTR binding |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:31599428 | has_input UniProtKB:O00206 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:26932538 | has_input UniProtKB:P84022 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:31599428 | has_input UniProtKB:O00206 |
involved_in | GO:0010629 negative regulation of gene expression |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:31599428 | has_input UniProtKB:O00206 |
involved_in | GO:0032689 negative regulation of type II interferon production |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:31599428 | occurs_in CL:0000235 |
involved_in | GO:0034144 negative regulation of toll-like receptor 4 signaling pathway |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:31599428 | has_input UniProtKB:O00206 |
involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:31599428 | has_input UniProtKB:O00206 |
involved_in | GO:0035279 miRNA-mediated gene silencing by mRNA destabilization |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:26932538 | has_input UniProtKB:P84022 |
involved_in | GO:0039531 regulation of cytoplasmic pattern recognition receptor signaling pathway |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:31599428 | occurs_in CL:0000235 |
MicroRNA-mRNA interaction maps from Argonaute CLIP-Seq and Degradome-Seq data.
Target Gene ID | Target Gene Name | Number of supporting experiments | Number of target-predicting programs | Maximum number of target sites | Chromosome | Target-predicting region start | Target-predicting region end | Strand |
---|
A manually curated database, aimed at providing a comprehensive resource of miRNA deregulation in various human diseases.
Click here for more information and to obtain references for the studies.
Disease | Differential expression | Experiment | Year | Study |
---|