Mature hsa-miR-223-5p
| Accession | MIMAT0004570 |
| Description | hsa-miR-223-5p mature miRNA |
| Hairpins | |
| Sequence | CGUGUAUUUGACAAGCUGAGUU |
| Evidence |
experimental
cloned [2] |
| Database links |
|
| Predicted targets |
|
QuickGo Function
QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.
| Qualifier | GO term | Evidence | Reference | Annotation Extension |
|---|---|---|---|---|
| involved_in | GO:0050728 negative regulation of inflammatory response |
ECO:0000250 sequence similarity evidence used in manual assertion |
PMID:GO_REF:0000024 | occurs_in UBERON:0002349 |
| involved_in | GO:0060546 negative regulation of necroptotic process |
ECO:0000250 sequence similarity evidence used in manual assertion |
PMID:GO_REF:0000024 | occurs_in UBERON:0002349 |
| located_in | GO:0005615 extracellular space |
ECO:0007005 high throughput direct assay evidence used in manual assertion |
PMID:26646931 | part_of UBERON:0001969 |
