Mature sequence hsa-miR-493-5p

• Accession number: MIMAT0002813
• ID: hsa-miR-493-5p
• Previous IDs: hsa-miR-493;hsa-miR-493-5p;hsa-miR-493*
• Stem-Loop: hsa-mir-493
• Sequence: uuguacaugguaggcuuucauu
• Deep sequencing: 7203 reads, 117 experiments
• Database links:
  • RNAcentral:URS0000077AED_9606
• Predicted targets:
  • TargetMiner:hsa-miR-493-5p
  • TargetScanVert:hsa-miR-493-5p
  • miRDB:hsa-miR-493-5p
  • microrna.org:hsa-miR-493-5p

References

1. PMID:15965474 "Identification of hundreds of conserved and nonconserved human microRNAs" Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z Nat Genet. 37:766-770(2005).
2. PMID:16274478 "Identification of clustered microRNAs using an ab initio prediction method" Sewer A, Paul N, Landgraf P, Aravin A, Pfeffer S, Brownstein MJ, Tuschl T, van Nimwegen E, Zavolan M BMC Bioinformatics. 6:267(2005).
3. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).