Mature sequence ptr-miR-99a

Accession numberMIMAT0002411
IDptr-miR-99a
Stem-Loop ptr-mir-99a
Sequence
aacccguagauccgaucuugug
Get sequence
Deep sequencing reads, experiments
Predicted targets

References

1
PMID:15652478 "Phylogenetic shadowing and computational identification of human microRNA genes" Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E Cell. 120:21-24(2005).