Mature sequence dre-miR-153c-3p

Accession numberMIMAT0001850
IDdre-miR-153c-3p
Previous IDsdre-miR-153c
Stem-Loop dre-mir-153c
Sequence
uugcauagucacaaaaaugauc
Get sequence
Deep sequencing6813 reads, 11 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).