Mature sequence dre-miR-133c-3p

Accession numberMIMAT0001832
IDdre-miR-133c-3p
Previous IDsdre-miR-133c
Stem-Loop dre-mir-133c
Sequence
uuuggucccuuucaaccagcua
Get sequence
Deep sequencing7095 reads, 8 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).