Mature sequence dre-miR-29b

Accession numberMIMAT0001801
IDdre-miR-29b
Stem-Loop dre-mir-29b-1 dre-mir-29b-2
Sequence
uagcaccauuugaaaucagugu
Get sequence
Deep sequencing2126 reads, 11 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).