Mature sequence gma-miR398a

Accession numberMIMAT0001689
IDgma-miR398a
Stem-Loop gma-MIR398a
Sequence
uguguucucaggucaccccuu
Get sequence
Deep sequencing reads, experiments

References

1
"Conservation and divergence of microRNA families in plants" Dezulian T, Palatnik JF, Huson DH, Weigel D http://genomebiology.com/2005/6/11/p13 (2005).