Mature hsa-miR-451a
| Accession | MIMAT0001631 |
| Description | hsa-miR-451a mature miRNA |
| Hairpins | |
| Sequence | AAACCGUUACCAUUACUGAGUU |
| Evidence |
experimental
cloned [1-3] |
| Database links |
|
| Predicted targets |
|
QuickGo Function
QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.
| Qualifier | GO term | Evidence | Reference | Annotation Extension |
|---|---|---|---|---|
| acts_upstream_of | GO:0032410 negative regulation of transporter activity |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:18645025 | |
| acts_upstream_of | GO:1905700 negative regulation of xenobiotic detoxification by transmembrane export across the plasma membrane |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:18645025 | |
| enables | GO:0003730 mRNA 3'-UTR binding |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:18645025 | has_input UniProtKB:P08183 |
| enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:18645025 | has_input UniProtKB:P08183 |
| involved_in | GO:0010629 negative regulation of gene expression |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:20816946 | has_input UniProtKB:P14780 |
| involved_in | GO:0030336 negative regulation of cell migration |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:20816946 | |
| involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:18645025 | has_input UniProtKB:P08183 |
| involved_in | GO:0035470 positive regulation of vascular wound healing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:25006399 | occurs_in CL:0000359 |
| involved_in | GO:0043065 positive regulation of apoptotic process |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:20816946 | |
| involved_in | GO:1904754 positive regulation of vascular associated smooth muscle cell migration |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:25006399 | occurs_in UBERON:0002012 |
| involved_in | GO:2000134 negative regulation of G1/S transition of mitotic cell cycle |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:20816946 | |
| located_in | GO:0005615 extracellular space |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:20159880 | part_of UBERON:0001969 |
| located_in | GO:0005615 extracellular space |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:25203061 | part_of UBERON:0001969 |
| located_in | GO:0005615 extracellular space |
ECO:0007005 high throughput direct assay evidence used in manual assertion |
PMID:26646931 | part_of UBERON:0001969 |
| located_in | GO:0070062 extracellular exosome |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:28159509 | part_of UBERON:0002409 |
| located_in | GO:0070062 extracellular exosome |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:31926946 | produced_by CL:0000235 |
| located_in | GO:1903561 extracellular vesicle |
ECO:0007005 high throughput direct assay evidence used in manual assertion |
PMID:28798470 | produced_by CL:0000182 |
StarBase
MicroRNA-mRNA interaction maps from Argonaute CLIP-Seq and Degradome-Seq data.
| Target Gene ID | Target Gene Name | Number of supporting experiments | Number of target-predicting programs | Maximum number of target sites | Chromosome | Target-predicting region start | Target-predicting region end | Strand |
|---|
miR2Disease
A manually curated database, aimed at providing a comprehensive resource of miRNA deregulation in various human diseases.
Click here for more information and to obtain references for the studies.
| Disease | Differential expression | Experiment | Year | Study |
|---|
