Mature sequence dre-miR-181a-5p

Accession numberMIMAT0001623
IDdre-miR-181a-5p
Previous IDsdre-miR-181a
Stem-Loop dre-mir-181a-1 dre-mir-181a-2 dre-mir-181a-4 dre-mir-181a-3 dre-mir-181a-5
Sequence
aacauucaacgcugucggugagu
Get sequence
Deep sequencing4592586 reads, 11 experiments

References

1
PMID:12624257 "Vertebrate microRNA genes" Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP Science. 299:1540(2003).
2
PMID:26473382 "A Uniform System for the Annotation of Vertebrate microRNA Genes and the Evolution of the Human microRNAome" Fromm B, Billipp T, Peck LE, Johansen M, Tarver JE, King BL, Newcomb JM, Sempere LF, Flatmark K, Hovig E, Peterson KJ Annu Rev Genet. 49:213-242(2015).