Mature sequence sbi-miR395d

Accession numberMIMAT0001432
IDsbi-miR395d
Previous IDssbi-MIR395d
Stem-Loop sbi-MIR395d
Sequence
gugaaguguuugggggaacuc
Get sequence
Deep sequencing reads, experiments

References

1
"Conservation and divergence of microRNA families in plants" Dezulian T, Palatnik JF, Huson DH, Weigel D http://genomebiology.com/2005/6/11/p13 (2005).