Mature sequence gga-miR-203a

Accession numberMIMAT0001146
IDgga-miR-203a
Previous IDsgga-miR-203
Stem-Loop gga-mir-203a
Sequence
gugaaauguuuaggaccacuug
Get sequence
Deep sequencing6013 reads, 5 experiments
Database links
Predicted targets
QuickGO function

References

1
" McBride D, Carre W, Law A, Clinton M Unpublished.
2
PMID:15592404 "Sequence and comparative analysis of the chicken genome provide unique perspectives on vertebrate evolution" International Chicken Genome Sequencing Consortium Nature. 432:695-716(2004).