miRBase entry: gga-mir-203a

Stem-loop gga-mir-203a


Accession
MI0001214
Description
Gallus gallus gga-mir-203a precursor miRNA mir-203
Gene
family?
RF00696; mir-203

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

WARNING: This summary was generated by AI. gga-mir-203 is a microRNA that has been identified as significantly differentially expressed across various chicken groups, with notable expression changes particularly in the CM group compared to the CS group [PMC5203650]. This miRNA has been quantified using specific primer sets in a real-time detection system, highlighting its relevance in gene expression studies [PMC4123083]. The sequence of gga-mir-203 has been cloned for experimental purposes to facilitate the study of its interactions with target genes [PMC5964199]. One such target is TP63 mRNA, which is involved in myogenic differentiation and has been shown to be downregulated upon transfection with a gga-mir-203 mimic in chicken primary myoblasts [PMC6157316]. The direct interaction between gga-mir-203 and TP63 mRNA was confirmed through a dual-luciferase reporter gene assay, which supports the prediction that TP63 is a direct target of gga-mir-203 [PMC6157316]. This interaction was further corroborated by conservation analysis across vertebrates and by using predictive software [PMC6157316]. Functional studies involving co-transfection of gga-mir-203 mimic and TP63 3′UTR reporter constructs into chicken cells have provided insights into the role of this miRNA as a negative regulator of myogenic differentiation, which aligns with the known functions of TP63 in muscle differentiation processes [PMC6157316]. Additionally, gga-mir-203 was one of only two miRNAs found to be significantly differentially abundant across both condition and line comparisons in chickens, indicating its potential importance across different genetic backgrounds or environmental conditions [PMC4256448].

Literature search
22 open access papers mention gga-mir-203a
(177 sentences)

Sequence

126875 reads, 534.0 reads per million, 234 experiments
cucagccuccuuggugcAGUGGUUCUUAACAGUUCAACAguucucuaucauaauuGUGAAAUGUUUAGGACCACUUGaccagcgaggcccgggcaucg
(((.(((((.(((((..(((((((((.((((.((((.(((((.........))))))))).)))).)))))))))..))))).)))))..))).....

Structure
-----   -a     c     gc         U    G    A     cuc 
     cuc  gccuc uuggu  AGUGGUUCU AACA UUCA CAguu   u
     |||  ||||| |||||  ||||||||| |||| |||| |||||   a
     ggg  cggag gacca  UCACCAGGA UUGU AAGU Guuaa   u
gcuac   cc     c     GU         U    A    -     uac 


Annotation confidence High
Do you think this miRNA is real?

Genome context
5: 50197309-50197406 [+]
Clustered miRNAs
1 other miRNA is < 10 kb from gga-mir-203a
Name Accession Chromosome Start End Strand Confidence




Database links

Mature gga-miR-203a-5p

Accession MIMAT0051210
Description Gallus gallus gga-miR-203a-5p mature miRNA
Sequence 18 - AGUGGUUCUUAACAGUUCAACA - 39
Evidence experimental
cloned [2]

Mature gga-miR-203a-3p

Accession MIMAT0001146
Description Gallus gallus gga-miR-203a-3p mature miRNA
Sequence 56 - GUGAAAUGUUUAGGACCACUUG - 77
Evidence experimental
cloned [2]
Database links
Predicted targets

References

  1. PubMed ID: 15592404
    Sequence and comparative analysis of the chicken genome provide unique perspectives on vertebrate evolution
    "International Chicken Genome Sequencing Consortium"
    "Nature (2004) 432:695-716


  2. "McBride D, Carre W, Law A, Clinton M"
    (None) None: