Mature sequence hsa-miR-365a-3p

• Accession number: MIMAT0000710
• ID: hsa-miR-365a-3p
• Previous IDs: hsa-miR-365
• Stem-Loop: hsa-mir-365a
• Sequence: uaaugccccuaaaaauccuuau
• Deep sequencing: 221267 reads, 159 experiments
• Database links:
  • RNAcentral:URS00003E7283_9606
• Predicted targets:
  • TargetMiner:hsa-miR-365a-3p
  • TargetScanVert:hsa-miR-365a-3p
  • miRDB:hsa-miR-365a-3p
  • microrna.org:hsa-miR-365a-3p

References

1. PMID:15735639 "Systematic discovery of regulatory motifs in human promoters and 3' UTRs by comparison of several mammals" Xie X, Lu J, Kulbokas EJ, Golub TR, Mootha V, Lindblad-Toh K, Lander ES, Kellis M Nature. 434:338-345(2005).
2. PMID:15965474 "Identification of hundreds of conserved and nonconserved human microRNAs" Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z Nat Genet. 37:766-770(2005).
3. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4. PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).