Mature sequence hsa-miR-301a-3p

• Accession number: MIMAT0000688
• ID: hsa-miR-301a-3p
• Previous IDs: hsa-miR-301;hsa-miR-301a
• Stem-Loop: hsa-mir-301a
• Sequence: cagugcaauaguauugucaaagc
• Deep sequencing: 81204 reads, 151 experiments
• Database links:
  • RNAcentral:URS00001C11BC_9606
• Predicted targets:
  • TargetMiner:hsa-miR-301a-3p
  • TargetScanVert:hsa-miR-301a-3p
  • miRDB:hsa-miR-301a-3p
  • microrna.org:hsa-miR-301a-3p

References

1. PMID:12919684 "Embryonic stem cell-specific MicroRNAs" Houbaviy HB, Murray MF, Sharp PA Dev Cell. 5:351-358(2003).
2. PMID:15183728 "Human embryonic stem cells express a unique set of microRNAs" Suh MR, Lee Y, Kim JY, Kim SK, Moon SH, Lee JY, Cha KY, Chung HM, Yoon HS, Moon SY, Kim VN, Kim KS Dev Biol. 270:488-498(2004).
3. PMID:15634332 "New human and mouse microRNA genes found by homology search" Weber MJ FEBS J. 272:59-73(2005).
4. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).